Solved by a verified expert:Name:Final Exam for BIOL 302 Bacteria, Viruses, and Health Summer 2016This is an open-book take-home final exam. The exam is cumulative and covers all five of thecourse modules and the related conference topics and activities.Your exam must be submitted to your assignment folder "Final Exam: no later than 11:59 p.m.Eastern Time, July 24. Late submissions will not be graded and will earn 0 points. Email,scanned, and PDF copies are not acceptable.There are three (3) parts to the final exam with a total possible100 points:Part A. Multiple Choice (20 questions for 1 point each)Part B. Short Answer (4 questions for 5 points each)Part C. Short Essay (6 questions for 10 points each)Responses to Parts B and C must be written as complete sentences and in your own words (seePurdue Online Writing Lab (OWL), "Paraphrase: Write in Your Own Words"(http://owl.english.purdue.edu/owl/resource/563/02/ ). You must include complete citations inAPA style for the sources of your information (see additional instructions about citations in week8 Course Content “About the Final Exam”. No points will be earned for answers that do notinclude complete and accurate citations for the sources of information used to answer thequestion or that support your answer.Submit your answers as a Word attachment (Start the file name of theattachment with your last name-for example student John Smith would beSmith J.Final Exam. doc); points will be deducted for not doing so.Part A Multiple Choice: Select the best or most complete answer (1 point each)1. In the lab you use the gram staining procedure, a differential staining technique, as a first stepin identifying the type of bacteria on a slide. After you carefully perform the stainingprocedure, you look at the cells under the microscope and see purple rod shaped cells. Thisresult indicates thata. the cells have a thick peptidoglycan layer as part of the physical structure of thecell wall and are gram-positive bacilli.b. the cells have a thin peptidoglycan layer as part of the physical structure of the cellwall and are gram-positive bacilli.c. the cells have a thin peptidoglycan layer as part of the physical structure of the cellwall and are gram-negative cocci.d. the cells have a thin peptidoglycan layer as part of the physical structure of the cellwall and are gram-negative bacilli.e. the cells have a thick peptidoglycan layer as part of the physical structure of thecell wall and are gram-negative bacilli.22. Which of the following infectious diseases has (or have) been eradicated in the world?a. poliob. measlesc. smallpoxd. whooping coughe. all of the above3. Which of the followings is a characteristic of prions that is unique from other knownpathogenic microbes?a. They lack the characteristics of a classic cell.b. They can be transmitted from animals to man.c. They cause permanent damage to the host.d. They are made entirely of protein.4. The first microorganism demonstrated to satisfy Koch’s postulates (in the late 19th century)wasa. Mycobacterium tuberculosisb. Bacillus anthracisc. Mycobacterium lepraed. Vibrio cholera5. Which of the following is a characteristic of the adaptive immune response and not of theinnate immune response?a. Physical and chemical barriersb. Clonal expansions of activated B cellsc. Inflammatory mediatorsd. Phagocytosis6. What does each codon in messenger RNA (mRNA) specify?a. a nucleotideb. an enzymec. an amino acidd. a promoter37. Antigens area. specific.b. proteins or polysaccharides (complex sugars).c. recognized as foreign by the body’s immune system.d. all of the above.8. Oncogenes are genes thata. the virus utilizes to replicate itself.b. transform normal cells to cancer cells.c. promote genetic recombination in bacteria.d. influence ongoing protein production.9. Genes A, B, and C are three structural genes of an operon and fall in that order within theoperon. A mutation occurs in Gene A that halts transcription early in the gene. What effectwill this have on the levels of proteins produced by Genes A, B, and C?a. No proteins coded by genes A, B, and C will be produced.b. Proteins coded by genes B and C, but not gene A, will be producedc. Proteins coded by genes A, B, and C will be produced.d. Only proteins coded by gene A will be produced.10. Plasmidsa. replicate with the bacterial chromosome.b. may contain antibiotic resistance genes.c. are as large as the bacterial chromosome.d. contain genes essential for growth.11. Interferons are an important part of the host defense against viral infections. Their principalmode of action is thata. they trigger the synthesis of one or more cellular proteins that inhibit viralreplication.b. they are present in the serum of healthy individuals and act as viral surveillancefactors.c. they coat viral particles and block their attachment to cells.d. they protect the death of a viral-infected cell.412. The form of genetic exchange by which donor DNA is introduced into a recipient bacterialcell by a bacterial virus isa. transformation.b. conjugation.c. transduction.d. transfection.e. vertical transfer.13. Viruses usually initiate infection by first interacting with receptors on the surface of cells.Which of the following statements is most accurate about cellular receptors for viruses?a. Cellular receptors for viruses have no known function.b. All viruses within a given family use the same cellular receptor.c. All cells in a susceptible host will express the viral receptor.d. Successful infection of a cell by a virus may involve the interaction with more thanone type of receptor.14. What was Edward Jenner’s contribution to microbiology?a. He discovered how to create a vaccine to trigger the body’s immune system todevelop antibodies that fight microbes.b. He proposed the germ theory.c. He developed the compound microscope.d. He developed the binomial nomenclature system.15. The production of RNA using DNA as a template is known asa. transduction.b. transformation.c. transcriptiond. translation.16. Humoral immunity involves the secretion of antibodies froma. T cells.b. macrophages.c. neutrophils.d. plasma cells.517. Which of the following describes the correct relationship between the major structures of avirus?a. The envelope encloses the genome of the virus.b. The capsid encloses the genome of the virus.c. The capsid encloses the envelope of the virus.d. The genome encloses the capsid of the virus.18. Immunity that results when a person is vaccinated against the 2009-H1N1 influenza isa. active artificially acquired immunity.b. passive naturally acquired immunity.c. active naturally acquired immunity.d. passive artificially acquired immunity.19. What are some benefits of our microbiome?a. It can supply essential nutrients.b. It can aid in preventing the colonization of pathogens.c. It can ensure proper functioning of the host immune systemsd. It can aid in food digestion.e. All of the above20. Protein toxins that may interfere with host cell function or damage host cell membranes andare usually secreted by living bacteria are calleda. adhesion factors.b. antibodies.c. exotoxinsd. endotoxins.6Part B. Short Answer (5 points each)Answer the questions below as completely and as thoroughly as possible and where appropriateinclude a specific example to illustrate. Answer the question in essay form (not as an outline oras bullets) using complete sentences. Cite sources of information you used to answer thequestions or that support your answer.21. Explain how genetic information is transferred from DNA to RNA to proteins. Include theterms DNA replication, transcription, translation, the principal events and enzymes. Use thefollowing DNA molecule to illustrate each stage.3′ TACTAGCCACATCTACCGATC 5′ Template strand used for transcription5′ ATGATCGGTGTAGATGGCTAG 3′ Coding (“inactive” strand)22. An electron micrograph shows a structure with a rigid outer wall, a membrane, ribosomes, anonmembrane bound nuclear area, and no endoplasmic reticulum or mitochondria. Explainwhy the structure is or is not each of the following: a human T cell, a virus, a bacterial cell, ayeast cell.23. Describe the difference between an emerging and a re-emerging disease and give a recentexample of a viral or a bacterial infection of each and explain the reason for thatclassification.24. Name the four types of acquired immunity and describe the mechanisms by which aperson acquires the immunity (“how it is conferred”). In a table describe thefollowing characteristics for each them: type of immunizing agent (antibodies orantigen), relative time for immunity to appear, relative time the immunity lasts, andthe source of antibodies (for example, self or non-self) that act against a pathogen orother antigenPart C. Short Essay (10 points each)Answer the questions below as completely and as thoroughly as possible and where appropriateinclude a specific example to illustrated. Answer the question in essay form (not as an outlineor as bullets) using complete sentences. You may use diagrams to supplement your answers, buta diagram alone without appropriate discussion will not be adequate for full credit. Cite sourcesof information you used to answer the questions or that support your answer.25. Your doctor diagnosed your illness as a bacterial sinus infection and prescribed a course ofantibiotics. You also gave informed consent to participate in the doctor’s research study onantibiotics. As part of the study you went to the clinic every day to have a sample from theinfection taken and analyzed. Before starting on the antibiotics the bacteria were susceptibleto the antibiotic; however later in the week after starting the antibiotic treatment the bacteriain your infection were resistant to the antibiotic. Results of DNA analysis of the bacteriacausing your infection showed that the resistant bacteria and susceptible bacteria differedonly by a gene that encodes the protein target of the antibiotic such that the antibiotic wasunable to bind to the target site on the resistant bacterial cells..7Which of the following three hypotheses is most likely? Explain how the results support thathypothesis and what you learned about antibiotic resistance in week 4 topic “AntibioticResistance”. What is a possible mechanism for the change in the gene?A) You developed a tolerance* for the antibioticB) The bacteria infecting you developed a tolerance* for the antibiotic.C) The bacteria infecting you evolved to be resistant to the antibiotic.*Tolerance is a nongenetic change in which the response to a specific drug and concentrationis weaker after repeated use.26. Describe how the first and second lines of defense of your innate immune system can protectyou from an influenza A infection. Recall from week 7 course content topic “About InfluenzaViruses” that influenza is a respiratory disease. Be specific about the tissues, cells, andprocesses involved and as related to influenza or other respiratory viral diseases. You mightfind "The Innate Immune System Study Guide" in course Module 5 helpful.27. List the stages of the viral life cycle and briefly describe the principal events in the stages ofthe life cycle of a virus in the Retroviridae family and explain what makes viruses in thatfamily difficult to eliminate from the host. Name a virus in that family.28. Explain why a secondary antibody response to an antigen may prevent a bacterial or viraldisease when the primary adaptive immune response to that antigen did not protect theperson from the disease. Be specific about the type of cells and products involved in theresponses.29. Read the following Science Daily article:NIH/National Institute of Allergy and Infectious Diseases. (2016, March 16). Experimentaldengue vaccine protects all recipients in virus challenge study. ScienceDaily. Retrieved July17, 2016 from www.sciencedaily.com/releases/2016/03/160316151106.htmWrite a brief summary (one paragraph) about the study that answers the following questions:What was the purpose of the clinical trial? What was the overall design of the trial? Whatwere the independent and dependent variables? What was the control and was it a positive ora negative control? What were the results of the experiments and the major importance ofthe findings? Did the trial demonstrate that the vaccine prevented dengue? Why or why not?Summarize the results in a table. In your summary explain the following terms: viruschallenge study, viremia, and attenuated vaccine.30. In week 7 topics you learned that genetic reassortment is a mechanism by whichnew influenza virus subtypes are produced. Using a virus with an a threesegmented RNA genome as an example, describe and illustrate thisprocess and include an example of genetic reassortment that resulted in amajor change in the genome (antigenic shift ) creating a new influenza Asubtype. Show all possible outcomes. If you copy/paste an illustration youmust describe in detail what it shows and how it supports your conclusion.
Recent Comments