Academic coaching, editing, and research guidance for university students.

Expert answer:Identification of Unknown Bacteria by sequencing r

3 min read
  

Solved by a verified expert:Rubric # 8
Name ________ ____________________
REPORT 6: Identification of Unknown Bacteria by sequencing
rDNA (50 pts).
1. Fill out responses
on THIS document.
2. You may reformat
to fit in your responses on this document
3. Handwritten report
is not acceptable
4. Email submission
is not acceptable

_______ 4.0 pts. A. How did you prepare template DNA from
your unknown bacteria? B. Name the
target DNA (from template DNA) being used for identification? C. Why did we choose
this region for identification of your unknown organism? D. What is the size (in bp) of target DNA in
Escherichia coli?
A. Heat
lysis followed by centrifuge to collect the clear supernatant
B. DNA of
16SrRNA gene region
C. This
conserved region helps us to identify the bacteria
D. The size
of target DNA in Escherichia coli is 800 bp

__________ 5.0 pts.
A. What are conserved regions in rDNA? B. Name the technique used to
amplify desired target DNA and explain why we need to amplify target DNA? C. Where,
in the target DNA, do the primers bind during PCR? D. How many variable regions
are present in rDNA? E. Copy and paste the schematic diagram to show the
variable and conserved region alone with primer binding regions
A. The
conserved regions in rDNA are the sequence of nucleotides that never changed
between rDNA in the organisms.
B.

__________4.0 pts. A. Why did you run agarose gel
electrophoresis? B. Did PCR work for
both organisms A and B? (Insert image of agarose gel electrophoresis here). C.
What is the expected size of your PCR product? D. What was the purpose of NTC?

_________ 4.0 pts. List the reagents used in preparing
master mix for PCR and write one sentence about why each one was necessary.

________ 3.0 pts. How
do you know that your amplified PCR product is the target region?

________ 6.0 pts. A.
What is the principle of Sangers’ sequencing technique? B. Use a labeled diagram (may copy &
paste image from internet) to briefly describe the technique [3 point]. C.
Write one advantage and one disadvantage of sequencing DNA by this
technique. D. Name two other sequencing
techniques that can be used to obtain nucleotide sequence of your PCR product.

__________4.0 pts. A.
Enter your sequence data here (for A & B).
B. Which variable regions are included in your PCR product? C. What is
the advantage of sequencing these regions?
A.
Organism A
GTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACGAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTTGGAGGTTGTGCC
Organism
B
CAGGATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAACGGACGAGAAGCTTGCTTCTCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGATAACCTACCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCGGATAATATTTTGAACCGCATGGTTCAAAAGTGAAAGACGGTCTTGCTGTCACTTATAGATGGATCCGCGCTGCATTAGCTAGTTGGTAAGGTAACGGCTTACCAAGGCAACGATGCATAGCCGACCTGAGAGGGTGATCGGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACATATGTGTAAGTAACTGTGCACATCTTGACGGTACCNAATCAGAAAGCCACGGCTAACTACGTGTAAAACTCTGTTATTAGGGAAGAACATATGTGTAAGTAACTGTGCACATCTTGACGGTACCNAATCAGAAAGCCACGGCTAACTACGTGTAAAACTCTGTTATTAGGGAAGAACATATGTGTAAGTAACTGTGCACATCTTGACGGTACCNAATCAGAAAGCCACGGCTAACTACGT

B.

_________ 1.0 pt. Will you be able to identify your unknown
organism(s) if you used DNA sequence for conserved regions instead of variable
regions? (Yes or No)
No, we
will now be able to identify our unknown organism(s) if we used DNA sequence
for conserved regions instead of variable regions.

________ 3.0 pt. A.
Write the acronym for RDP. B. In
addition to using DNA sequence data for identification, list two other uses.
A. The
acronym for RDP is Ribosomal Database Project
B. Two other
uses:
– Clone
checking
– Bacterial
typing

__________10.0 pt. What organism is the best match based on
the nucleotide sequence you searched? Bonus points (5.0) if you can identify
both correctly.

Organism A
_____________
______________

(Genus 5.0 pts)
(Species 5.0 pts)

Organism B
_____________
______________

(Genus 2.5 pts)
(Species 2.5 pts)

_________6.0 pts. Write one advantage and one disadvantage
for each of the following identification (finding genus and species names)
methods for unknown organisms used this semester:

Advantage Disadvantage
Morphological Unknown I
Biochemical Unknown II
Sequencing Unknown III

Academic integrity note

Use this educational resource to build your understanding. Follow your institution’s rules and cite sources appropriately.

Want feedback on your own work?

Request Academic Support