Solved by a verified expert:The
answers don’t have to be long 3 to 4 sentence and if you are using another
author’s word please give me a reference if any I will have to turn this into
turnitin.com a site for plagiarism. Thanks!
Choose 1 out of the 2 activity to do
·Activity 1 – DNA Decoder (1 activity required)
Discussion Topic
For
this activity I am going to give you a strand of RNA to decode to answer a
question. Use this RNA to figure out what the strand of DNA was that it
was encoded from. Then, use this DNA to answer the question. (you do not
need to provide a reference)
1. Question:
What happens to a duck who flies upside down?
2. Strand of RNA:
CUCGAAUACCCAAUUGCAGAGCGGCAGUACAUUCCC
3. Make a complimentary strand of DNA. (please note that the RNA is in
capital letters so your DNA should also be in capital letters)
Decode message using the complimentary strand of DNA by going to the
DNA-o-gram decoder.
http://www.thinkbiotech.com/DNA-o-gram/
4. While at the website, mutate
your DNA and see what happens. Add 1 base, add 3 bases, take away one
base, take away 3 bases, make a base-pair substitution. Try these changes both
in the middle of your strand and on an end.
5.Respond to this conference by reporting what the decoded message is and
explain the importance of even a single mutation in biological systems and
provide an example.
Extra
Help
In transcription and translation you
start with DNA found in the nucleus, then RNA makes a copy of
the DNA as instructions to make proteins. In DNA
a C always pairs with a G and a T always pairs
with an A. So, if I gave you a strand of DNA (AATTCCGG) and asked
you to make its compliment you would make (TTAAGGCC).
RNA uses a U instead
of a T. So, if I asked you to make a strand of RNA from
the DNA (AATTCCGG) the complimentary RNA would be
(UUAAGGCC).
This problem asks you to figure out
what the complimentary DNA strand was that the RNA was
coded from. So, you start with the RNA, make a
complimentary DNA and then plug that code into the decoder to get the
answer to the problem.
Here is a problem and its answer
that you can use to make sure you understand how to solve it.
Question – What is your instructor’s
first name?
RNA provided – UUCCUACCUGACAGU
Complimentary DNA which you figure
out – AAGGATGGACTG TCA
Plug the complimentary strand of DNA
into the decoder and you should get “Cindy” as your answer.
·Activity 2 – Protein Synthesis (1 activity
required)
Please try the activity below.
Click on “DNA Replication” on the left to match up DNA
base pairs and then click on “Protein Synthesis” on the right to
practice the steps needed to make a protein from a DNA template using mRNA and
tRNA.
Please write about what you learned.
You do not need to include a reference.
DNA Workshop
http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html
Alternate activity if you have
technical difficulties with the first website.
http://learn.genetics.utah.edu/content/molecules/transcribe/
Recent Comments