writing summary for research paper.

  

I want to do summary for research paper. Also, this summary require something that i will download by field for you. explaining each graph or image in research paper , please. Thank you
bio_3.pdf

20170228061152new_doc_2017_01_27_10.02.19.bio_2.pdf

Unformatted Attachment Preview

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 28, pp. 19395–19407, July 11, 2014
© 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.
Molecular Cloning and Functional Characterization of
Components of the Capsule Biosynthesis Complex of
Neisseria meningitidis Serogroup A
TOWARD IN VITRO VACCINE PRODUCTION *□
S
Received for publication, April 18, 2014, and in revised form, May 19, 2014 Published, JBC Papers in Press, May 21, 2014, DOI 10.1074/jbc.M114.575142
Timm Fiebig‡1, Friedrich Freiberger‡1, Vittoria Pinto§, Maria Rosaria Romano§, Alan Black¶, Christa Litschko‡,
Andrea Bethe‡, Dmitry Yashunsky储, Roberto Adamo§, Andrei Nikolaev¶, Francesco Berti§2,
and Rita Gerardy-Schahn‡3
From the ‡Institute for Cellular Chemistry, Hannover Medical School, 30625 Hannover, Germany, §Novartis Vaccines,
Research, Via Fiorentina 1, 53100 Siena, Italy, ¶College of Life Sciences, University of Dundee, Dundee, DD1 5EH, Scotland,
United Kingdom, and the 储Institute of Biomedical Chemistry, Russian Academy of Medical Sciences, Pogodinskaya Street 10,
Moscow 119832, Russian Federation
Background: The isolation of capsular polysaccharides from pathogenic bacteria for vaccine production is cost-intensive.
Results: We describe the cloning, recombinant expression, and functional characterization of three enzymes from Neisseria
meningitidis serogroup A that facilitate in vitro synthesis of the capsule polymer.
Conclusion: The study presents a novel basis for efficient vaccine production.
Significance: Economic vaccine production is prerequisite to combat meningococcal diseases.
The human pathogen Neisseria meningitidis (Nm) is a leading
cause of bacterial meningitis and sepsis globally. A major virulence factor of Nm is the capsular polysaccharide (CPS), which
in Nm serogroup A consists of N-acetyl-mannosamine-1-phosphate units linked together by phosphodiester linkages [36)-␣ⴚ
D-ManNAc-(13 OPO3 3]n. Acetylation in O-3 (to a minor
extent in O-4) position results in immunologically active polymer. In the capsule gene cluster (cps) of Nm, region A contains
the genetic information for CPSA biosynthesis. Thereby the
open reading frames csaA, -B, and -C are thought to encode the
UDP-N-acetyl-D-glucosamine-2-epimerase, poly-ManNAc-1phosphate-transferase, and O-acetyltransferase, respectively.
With the aim to use a minimal number of recombinant enzymes
to produce immunologically active CPSA, we cloned the genes
csaA, csaB, and csaC and functionally characterized the purified
recombinant proteins. If recombinant CsaA and CsaB were
combined in one reaction tube, priming CPSA-oligosaccharides
were efficiently elongated with UDP-GlcNAc as the donor substrate, confirming that CsaA is the functional UDP-N-acetylD-glucosamine-2-epimerase and CsaB the functional polyManNAc-1-phosphate-transferase. Subsequently, CsaB was
shown to transfer ManNAc-1P onto O-6 of the non-reducing
end sugar of priming oligosaccharides, to prefer non-O-acetylated over O-acetylated primers, and to efficiently elongate the
dimer of ManNAc-1-phosphate. The in vitro synthesized CPSA
was purified, O-acetylated with recombinant CsaC, and proven
* This work was supported by the Deutsche Forschungsgemeinschaft (DFG)
in the framework of DFG Research Unit 548 (Ge801/10-1).
This article contains supplemental data and Schemes S1–S3.
Both authors contributed equally to this study.
2
To whom correspondence may be addressed. Tel.: 39-0577-243895; Fax:
39-0577-243564; E-mail: francesco.berti@novartis.com.
3
To whom correspondence may be addressed: Hannover Medical School,
Carl-Neuberg Str. 1, 30625 Hannover, Germany. Tel.: 49-511-532-9802; Fax:
49-511-532-8801; E-mail: gerardy-schahn.rita@mh-hannover.de.
to be identical to the natural CPSA by 1H NMR, 31P NMR, and
immunoblotting. If all three enzymes and their substrates were
combined in a one-pot reaction, nature identical CPSA was
obtained. These data provide the basis for the development of
novel vaccine production protocols.
NmA4 is the major cause of meningococcal disease in the
African meningitis belt. Besides seasonal epidemics that occur
with almost annual frequency, NmA has been the cause of
severe pandemics in the last century (1, 2). A major virulence
factor of Nm is the negatively charged capsular polysaccharide
(CPS). CPSA consists of N-acetyl-mannosamine-1-phosphate
units linked by phosphodiester linkages to give the polymer
[36)-␣-D-ManNAc-(13 OPO3⫺3]n (3). Of note, the six most
virulent Nm serogroups (NmA, -B, -C, -W, -Y, and -X) bear
negative CPSs. Negative charge in CPSA and CPSX is due to the
phosphodiester group, whereas negative charge in CPSB, -C,
-W, and -Y results from the incorporation of sialic acid (2).
These Nm CPSs are immunogenic (except CPSB, which is
identical to polysialic acid in the human host) and cause the
production of antibodies that are bactericidal in the presence of
complement (1, 4). In fact, this early observation has made the
use of polysaccharide-protein conjugates the gold standard in
the development of vaccines against Nm strains. A number of
mono- and tetravalent (the latter comprising serogroups A, C,
W, and Y) conjugate vaccines against Nm have been licensed
(5).
□
S
1
JULY 11, 2014 • VOLUME 289 • NUMBER 28
4
The abbreviations used are: NmA, Neisseria meningitidis serogroup A; AEC,
anionic exchange chromatography; DP, degree of polymerization; avDP,
averaged DP; CP, capsule polymerase; CPS, capsular polysaccharide; CPSA,
CPS of NmA; CPSAhyd, hydrolyzed CPSA; deP, dephosphorylated; CsaA,
UDP-GlcNAc-2-epimerase; CsaB, poly-ManNAc-1-phosphate-transferase;
CsaC, O-acetyltransferase; 1P, 1-phosphate.
JOURNAL OF BIOLOGICAL CHEMISTRY
19395
The Capsule Biosynthesis Machinery of NmA
FIGURE 1. The capsule biosynthesis gene cluster. A, schematic representation of the chromosomal locus (cps) of NmA. Products of genes forming region A
are involved in the synthesis of the capsule polysaccharide and are serogroup-specific. For more information, see the Introduction (adapted from Harrison et
al. (19)). B, reactions catalyzed by the gene products of csaA, csaB, and csaC (1). The putative UDP-N-acetyl-D-glucosamine-2-epimerase CsaA catalyzes the
epimerization of UDP-GlcNAc to UDP-ManNAc (2). The putative capsule polymerase CsaB transfers ManNAc-1P from the resulting UDP-N-acetyl-mannosamine
onto the non-reducing end of the growing CPSA (3). CsaC O-acetylates CPSA at O-3 or O-4 in the presence of the acetyl-donor acetyl-CoA.
Crucial to the success of vaccination programs in the subSaharan meningitis belt is the provision of safe high quality
vaccines. MenAfriVac威, a conjugate vaccine with CPSA coupled to tetanus toxoid as carrier protein, has been specifically
designed to address these needs (6). With a cost of under 50
cents per dose (7), mass vaccination campaigns were possible in
Burkina Faso, Mali, and Niger and installed herd immunity
(8 –10) protecting not only vaccinated but also non-vaccinated
individuals and young children (11).
Recent progress made with the cloning and functional
expression of capsule polymerases (CPs) (12–15) and pioneering studies that demonstrate the suitability of recombinant
enzymes for the in vitro production of CPSs (16, 17) have
opened new perspectives for the economic and safe production
of conjugate vaccines. The goal of our study, therefore, was to
isolate the minimal number of enzymes needed for in vitro synthesis of immunologically active CPSA and to pioneer protocols for the use of recombinant enzymes in CPSA production
chains. As the sugar building block UDP-ManNAc is commercially not available, it was clear from the start that establishing a
successful production chain requires the in situ synthesis of
UDP-ManNAc from cheap UDP-GlcNAc. Moreover, as the
immunogenicity of CPSA depends on O-acetylation (18), an
O-acetyltransferase capable to perform this modification was
necessary.
The chromosomal locus cps (for capsular polysaccharide
synthesis) contains the genetic information for CPS synthesis,
modification, and surface transport. The locus is sub-struc-
19396 JOURNAL OF BIOLOGICAL CHEMISTRY
tured into six regions: A–D, D⬘, and E (Fig. 1A). The sequences
encoded in region A are serogroup-specific and encode among
other things the polymerases responsible for CPS synthesis
(19). Regions B and C are highly conserved and encode the
proteins necessary for export and assembly of the polysaccharide on the cell surface. In NmA, region A comprises four open
reading frames (ORF) csaA, -B, -C, and -D (previously designated sacA-D or mynA-D). Using insertion-mutagenesis Swartley et al. (20) demonstrated that each of these genes is involved
in the production of the NmA capsule. In a later study the gene
product encoded in csaC was shown to be an acetyltransferase
with specificity for the O-3 and O-4 positions in ManNAc (21)
(Fig. 1B). Based on their nucleotide and predicted amino acid
sequence, csaA was presumed to encode a UDP-N-acetyl-Dglucosamine-2-epimerase and csaB to encode a capsule polymerase (20) (Fig. 1B). Additional evidence that the product of
csaB is in fact the NmA-specific capsule polymerase arose
from the demonstration that the protein is part of the stealth
family comprising exclusively D-hexose-1-phosphate transferases (22).
Here we describe the molecular cloning of the genes csaA,
csaB, and csaC from NmA, the production of recombinant proteins, and the characterization of their functional properties.
Testing a series of synthetic primer compounds, a ManNAc
dimer linked together by phosphodiester linkages and carrying
a phosphodiester at the reducing end was found to be the minimal acceptor structure. This artificial primer as well as oligosaccharide primers isolated from natural sources was preferenVOLUME 289 • NUMBER 28 • JULY 11, 2014
The Capsule Biosynthesis Machinery of NmA
TABLE 1
Primers used in this study
Restriction sites are highlighted in bold.
Primer pair
GCGGATCCAAAGTCTTAACCGTCTTTGGC
CCGCTCGAGTCTATTCTTTAATAAAGTTTCTACA
GCAGATCTTTTATACTTAATAACAGAAAATGGC
CCGCTCGAGTTTCTCAAATGATGATGGTAATG
CCGCTCGAGTTTCTCAAATGATGATGGTAATG
GCAGATCTATGTTAATTCCTATTAATTTTTTTAA
CCGCTCGAGTTTCTCAAATGATGATGGTAATG
GCATCTCATATGTTAATTCCTATTAATTTTTTTTAATTT
GCATCTCATATGCTGATCCCGATCAATTTCTTT
CCGCTCGAGTTTCTCGAAGGAGCTCGGC
CCGCTCGAGTATATTTTGGATTATGGT
GCGGATCCTTATCTAATTTAAAAACAGG
tially used by CsaB if presented in non-O-acetylated form.
Using a two-step production protocol, O-acetylated CPSA was
synthesized by enzyme-catalyzed reactions and purified to
homogeneity. Identity with the natural polymer was confirmed
by 1H and 31P NMR and immunoblotting.
EXPERIMENTAL PROCEDURES
General Cloning—The genomic DNA isolated from Nm
strain Z2491 was a kind gift from Dr. Heike Claus (Institute for
Hygiene and Microbiology, University of Würzburg). The csaB
sequence was codon-optimized for use in Escherichia coli
BL21(DE3) using the Gene Designer software package (DNA
2.0) (23) and the codon frequency tables published by Welch et
al. (24). The mean codon frequency for each amino acid was
calculated from the codon frequency tables FreqA and FreqB
(24), and the resulting codon frequency table was used as the
template for the in silico generation of csaBco. csaBco flanked 5⬘
by a BamHI site and 3⬘ by a XhoI site was synthesized from
Eurofins MWG Operon. All other csaA-C sequences described
herein were amplified by polymerase chain reaction (PCR)
using the primers shown in Table 1 and genomic DNA from
Nm strain Z2491 or csaBco as template. PCR products were
cloned via the restriction sites shown in Table 1 into the corresponding sites of the vector pET22b-Strep (25) driving the
expression of recombinant proteins under the control of the T7
promoter. PCR products digested with BglII were cloned into
the BamHI site of pET22b-Strep.
Expression and Purification of Recombinant CsaA, CsaB, and
CsaC—Freshly transformed E. coli BL21(DE3) were grown at
15 °C in PowerBroth medium for 18 h. At an optical density of
A600 ⫽ 1.0 protein expression was induced by the addition of
0.1 mM isopropyl-␤-D-1-thiogalactopyranoside and allowed to
proceed for a period of 20 h. In test expressions, 0.2 ml of culture-volume were pelleted with 16,000 ⫻ g for 1 min. Cell pellets were lysed with 0.1 ml of lysis buffer (50 mM Tris, pH 8.0, 2
mM EDTA, 0.1 mg/ml lysozyme). The lysis was intensified by 3
cycles of sonication (Branson sonifier 450, 100% amplitude)
interrupted by 3 min of cooling on ice. Soluble and insoluble
fractions were separated by centrifugation (16,000 ⫻ g, 30 min,
4 °C), and the supernatant was mixed (1:1) with Laemmli buffer
and used for PAGE as described below.
For protein purification, pellets from 125 ml of expression
culture were pelleted by centrifugation (6000 ⫻ g, 10 min, 4 °C).
After a washing step with PBS, cells were resuspended in 7.5 ml
JULY 11, 2014 • VOLUME 289 • NUMBER 28
Resulting construct
StrepII-CsaA-His6
StrepII-CsaB-His6
StrepII-⌬69-CsaB-His6
⌬69-CsaB-His6
⌬69-CsaBCo-His6
StrepII-CsaC-His6
of binding buffer (50 mM Tris, pH 8.0, 300 mM NaCl) complemented with 40 ␮g/ml bestatin (Sigma), 1 ␮g/ml pepstatin
(AppliChem), 100 ␮M PMSF (Stratagene) and sonicated (Branson Digital Sonifier, 50% amplitude, 8 ⫻ 30s, interrupted by
cooling on ice). After centrifugation at 27,000 ⫻ g for 30 min,
the soluble fractions were directly loaded onto HisTrap columns (GE Healthcare) to enrich the recombinant proteins by
immobilized metal ion affinity chromatography. Columns were
washed with binding buffer (50 mM Tris, pH 8.0, 300 mM NaCl),
and proteins were eluted in step gradients using 10, 30, 50, and
100% elution buffer (binding buffer containing 500 mM imidazole). Fractions containing recombinant protein were pooled,
and the buffer was changed to storage buffer (50 mM Tris, pH
8.0, 50 mM NaCl for CsaA/CsaB; 50 mM Hepes, pH 7.05, 100 mM
NaCl, 5 mM MgCl2, and 1 mM EDTA for CsaC) using the HiPrep
26/10 desalting column (GE Healthcare). Isolated proteins
were concentrated using Amicon Ultra centrifugal devices
(Millipore 30 MWCO). After separation into aliquots, samples
were snap-frozen in liquid nitrogen and stored at ⫺80 °C.
SDS-PAGE and Immunoblotting—SDS-PAGE was performed under reducing conditions using 2.5% (v/v) ␤-mercaptoethanol and 1.5% (w/v) SDS. Proteins were stained using
Roti-Blue (Carl Roth GmbH) according to the manufacturer’s
guidelines. For Western blot analysis samples and standard
proteins were blotted onto PVDF membranes (Millipore). Histagged proteins were detected with 0.5 ␮g/ml anti-penta-His
antibody (Qiagen) and goat anti-mouse IR680 or goat antimouse IR800 antibody (LI-COR) as second antibody. Second
antibodies were used in a 1:20,000 dilution.
Preparation of CPSA Oligosaccharides—CPSA oligosaccharide samples with an averaged degree of polymerization (avDP)
of 6 and 15, respectively, were generated by acidic hydrolysis of
long CPSA chains isolated from bacterial cultures (CPSAn).
Solutions containing 2.5 mg/ml CPSA in sodium acetate buffer
(50 mM sodium acetate, pH 4.8) were incubated at 73 °C for 6 h,
and 2 pool fractions (avDP 6 and 15, respectively) were purified
by anionic exchange chromatography (Q-Sepharose column,
GE Healthcare) using a sodium chloride gradient. The avDP
and the dispersion of saccharide chains was determined by 31P
NMR and high performance anionic exchange chromatography-pulsed amperometric detection (HPAEC-PAD) analysis
following an established protocol (26). If used in enzymatic
reactions, hydrolyzed CPSA (CPSAhyd) was dephosphorylated
JOURNAL OF BIOLOGICAL CHEMISTRY
19397
The Capsule Biosynthesis Machinery of NmA
FIGURE 2. Production of recombinant enzymes. A, Coomassie-stained SDS-PAGE of purified StrepII-CsaA-His6 (left panel) and StrepII-CsaC-His6 (right panel).
B, to select the construct most suited for the production of active recombinant CsaB, the wild type and a codon-optimized (CsaBco) version of the CsaB
sequence were cloned (full-length or after N-terminal truncation, ⌬69) to produce proteins with tags on both (StrepII and His6) or only one end (His6), as
indicated. Transformed bacteria were lysed, separated into soluble (s) and insoluble (i) fractions, and fractions were separately run on PAGE. After transfer onto
nitrocellulose, the blot was developed with an anti-penta-His antibody. m, marker. C, soluble fractions were used to measure CsaB activity in a radioactive
incorporation assay. D, Coomassie-stained gel demonstrating the purification result for ⌬69-CsaBco-His6 (IMAC, immobilized metal ion affinity chromatography; SEC, size exclusion chromatography).
(CPSAhyd-deP) using acid phosphatase (Sigma) according to
the manufacturer’s guidelines.
Chemical Synthesis of CsaB Acceptors—A short summary of
the synthesis of ManNAc and ManNAc derivatives as well as of
ManNAc disaccharide units linked together by phosphodiester
linkages is provided in the supplemental schemes S1 and S2. A
manuscript describing the detailed chemical synthesis and the
characterization of these compounds is under preparation.5
Activity Testing of CsaA/CsaB by Use of a Radioactive Assay
System—CsaA/CsaB activity was analyzed using an adaptation
of a radioactive incorporation assay previously described for
the N-acetylglucosamine-1-phosphate transferase from NmX
(17). Briefly, assays were carried out with 5 ␮l of the soluble
fractions of bacterial lysates expressing either recombinant
CsaB or CsaA (see Fig. 2C) or with purified and epitope-tagged
proteins (112 pmol of StrepII-CsaA-His6; 88 pmol of ⌬69CsaBcoHis6) in a total volume of 25 ␮l of assay buffer (50 mM Tris pH
8.0 or various pH for determination of the pH optimum). Divalent cations were added from stock solutions. The reaction was
primed with 5 ng of avDP15 and started by the addition of 0.05
␮mol of UDP-GlcNAc (Calbiochem) containing 0.05 ␮Ci of
UDP-[14C]GlcNAc (American Radiolabeled Chemicals). Samples were incubated at 37 °C, and 5-␮l aliquots were spotted
onto Whatman 3MM Chr paper after 0, 5, 10, and 30 min. After
descending paper chromatography, the chromatographically
5
D. V. Yashunsky, A. J. Black, and A. V. Nikolaev, manuscript in preparation.
19398 JOURNAL OF BIOLOGICAL CHEMISTRY
immobile 14C-labled CPSA was quantified by scintillation
counting.
Activity Testing of CsaA/CsaB by Use of a Multienzyme Spectrophotometric Assay—1.2 ␮M CsaA and 1 ␮M CsaB were
assayed in the presence of 0.25 mM UDP-GlcNAc (Calbiochem), 20 mM MgCl2, and 50 mM Tris, pH 8.0, in a total volume
of 100 ␮l. The consumption of UDP-GlcNAc was coupled to
nicotinamide adenine dinucleotide (NADH) consumption
using the following enzymes/substrates: 0.25 mM adenosine
triphosphate (ATP, Roche Applied Science), 1 mM phosphoenolpyruvate (ABCR), 0.3 mM NADH (Roche Applied Science),
9 –15 units/ml pyruvate kinase, 13.5–21 units/ml lactic dehydrogenase (PK/LDH mix Sigma), and 0.05 mg/ml nucleoside
monophosphate kinase (Roche Applied Science). Absorption
was measured at 340 nm every 10 s for 30 min using a Biotek EL
808 96-well plate reader.
Physicochemical Analysis of CPSAiv—To produce sufficient
CPSA (CPSAiv) for PAGE and NMR analyses, 0.84 nmol (1.2 ␮M
final) of StrepII-CsaA-His6 and 37.5 pmol (50 nM final) of
⌬69CsaBco-His6 in reaction buffer (50 mM Tris, pH 8.0, 20 mM
MgCl2) were incubated with 5 mM UDP-GlcNAc and 6.8 ␮g of
CPSAhyd of avDP6 after de-O-acetylation and dephosphorylation (CPSAhyd(deOAc)-deP). The total reaction volume was
adjusted to 750 ␮l. In control 1 shown in Fig. 6B, StrepII-CsaAHis6 was also used at 50 nM. Reactions as well as control samples
(containing reactants as indicated in Fig. 6) were incubated
overnight at 37 °C. 5 ␮l of each sample were then used for sepVOLUME 289 • NUMBER 28 • JULY 11, 2014
The Capsule Biosynthesis Machinery of NmA
aration on high percentage (25%) PAGE and visualized …
Purchase answer to see full
attachment